Sequence ID | >WENV170883025 |
Genome ID | MDTC01158447 |
Search identical group | |
Phylum/Class | [MDTC] marine metagenome; seawater |
Species | |
Start position on genome | 2104 |
End posion on genome | 2033 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcactaagaa |
tRNA gene sequence |
GGGCGAATAGCTCAGCGGTAGAGCTACTCGTTTACACCGAGTCGGTCGGGGGTTCGATCC |
Downstream region at tRNA end position |
tatgaggtta |
Secondary structure (Cloverleaf model) | >WENV170883025 Val TAC a Atta tatgaggtta G - C G - C G - C C - G G - C A - T A - T C T T C T C C C A G A A | + | | | G C C T C G G G G G G C G | | | | T T G G A G C T A T CGGTC A - T C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |