| Sequence ID | >WENV170887447 |
| Genome ID | MDTC01240139 |
| Phylum/Class | [MDTC] marine metagenome; seawater |
| Species | |
| Start position on genome | 27 |
| End posion on genome | 99 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
aaactgttaa |
| tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACACTGCCCTTTCACGGCGGCAACAGGGGTTCGAAT |
| Downstream region at tRNA end position |
aaatatcaat |
| Secondary structure (Cloverleaf model) | >WENV170887447 Glu TTC
a Ggtc aaatatcaat
G - C
T - A
C - G
C - G
C - G
C - G
A - T T A
T T C C C C A
A G A C | | | | | G
G T C T G A G G G G C
G + | | | T T
C G G A C
C T A A CAAC
C - G
T + G
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |