Sequence ID | >WENV170898299 |
Genome ID | MDTD01123733 |
Search identical group | |
Phylum/Class | [MDTD] marine metagenome; seawater |
Species | |
Start position on genome | 5734 |
End posion on genome | 5807 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cgccggatgt |
tRNA gene sequence |
TGGGGAATAGGTTAACGGTAGACCCACGGACTCTGACTCCGTTAGTCCTGGTTCGAATCC |
Downstream region at tRNA end position |
tttgatttca |
Secondary structure (Cloverleaf model) | >WENV170898299 Gln CTG t GCCA tttgatttca T - A G - C G - C G - C G - C A - T A - T T A T G G A C C A A A A | | | | | G C T T G G C C T G G C G + | | | T T G G A C C T A C TAGT A - T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |