| Sequence ID | >WENV170898523 |
| Genome ID | MDTD01127441 |
| Phylum/Class | [MDTD] marine metagenome; seawater |
| Species | |
| Start position on genome | 90 |
| End posion on genome | 163 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
ttcaaatttt |
| tRNA gene sequence |
GGCTGGGTGGCAGAGTGGTTATGCAGCGGCCTGCAAAGCCGTGGACGCCGGTTCGATTCC |
| Downstream region at tRNA end position |
taaccccttc |
| Secondary structure (Cloverleaf model) | >WENV170898523 Cys GCA
t TCCA taaccccttc
G - C
G - C
C - G
T - A
G - C
G - C
G - C T T
T C A G C C A
G A G | | | | G
T G A C G G C C G G C
G | | | T T
G A T G C
T T A GGAC
G + T
C - G
G - C
G - C
C - G
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |