Sequence ID | >WENV170900693 |
Genome ID | MDTD01158092 |
Search identical group | |
Phylum/Class | [MDTD] marine metagenome; seawater |
Species | |
Start position on genome | 161 |
End posion on genome | 86 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttttggtaat |
tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTAGAGCATCTCGTTTACACCGAGGGGGTCAAAGGTTCGAGT |
Downstream region at tRNA end position |
gacacacaag |
Secondary structure (Cloverleaf model) | >WENV170900693 Val TAC t ACCA gacacacaag G - C G - C G - C C - G G + T G - C T - A T G T T T T C C A T G A A | | | | | G T C T C G A A A G G C G | | | | T T G G A G C T A A GGGTC T + G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |