Sequence ID | >WENV170906283 |
Genome ID | MDTE01036553 |
Search identical group | |
Phylum/Class | [MDTE] marine metagenome; seawater |
Species | |
Start position on genome | 2919 |
End posion on genome | 2990 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agtaaacaac |
tRNA gene sequence |
GGGTCAGTAACTCAGTGGTAGAGTATTCGGCTTTTAACCGATTAGCCGTGGGTTCGAATC |
Downstream region at tRNA end position |
gagctgcaaa |
Secondary structure (Cloverleaf model) | >WENV170906283 Lys TTT c Aaaa gagctgcaaa G + T G - C G - C T - A C - G A - T G - C T A T C A C C C A G A A | | | | | G T C T C A G T G G G C G | | | | T T G G A G T T A A TAGCC T T T - A C - G G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |