Sequence ID | >WENV170911768 |
Genome ID | MDTE01111143 |
Search identical group | |
Phylum/Class | [MDTE] marine metagenome; seawater |
Species | |
Start position on genome | 2364 |
End posion on genome | 2437 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cctcgacgcg |
tRNA gene sequence |
GCGGGCGTCGCCAAGTGGTTAAGGCAGCGGCTTGTGGCGCCGCTATTCGGGGGTTCGAAT |
Downstream region at tRNA end position |
acccccatgt |
Secondary structure (Cloverleaf model) | >WENV170911768 His GTG g CCtc acccccatgt G - C C - G G - C G + T G - C C - G G - C T A T T C C C C A T G A C + | | | | G G A C C G G G G G G C G | | | T T T A G G C T A A TATTC G - C C - G G - C G - C C - G T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |