| Sequence ID | >WENV170926950 |
| Genome ID | MDTG01108932 |
| Phylum/Class | [MDTG] marine metagenome; seawater |
| Species | |
| Start position on genome | 3025 |
| End posion on genome | 3100 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
gttgagacat |
| tRNA gene sequence |
TCCCCGATAGCTCAGTCGGTAGAGCAGTAGACTGTTAATCTATTGGTCGCTGGTTCAAGT |
| Downstream region at tRNA end position |
tttttatatt |
| Secondary structure (Cloverleaf model) | >WENV170926950 Asn GTT
t GCCA tttttatatt
T - A
C - G
C - G
C - G
C - G
G - C
A - T T G
T C G A C C A
T G A A | | | | | A
C C T C G G C T G G C
G | | | | T T
G G A G C
T A A TGGTC
G + T
T - A
A - T
G - C
A - T
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |