| Sequence ID | >WENV170929925 |
| Genome ID | MDTG01158625 |
| Phylum/Class | [MDTG] marine metagenome; seawater |
| Species | |
| Start position on genome | 16352 |
| End posion on genome | 16278 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
aacacactca |
| tRNA gene sequence |
TGGGGTATCGCCAAGTGGTAAGGCAACGGCTTTTGGTGCCGTCATTCGAAGGTTCGAATC |
| Downstream region at tRNA end position |
cttacaattt |
| Secondary structure (Cloverleaf model) | >WENV170929925 Gln TTG
a TCCA cttacaattt
T - A
G - C
G - C
G - C
G - C
T - A
A - T T A
T C T T C C A
G A C | | | | | G
T A C C G G A A G G C
G | | | T T
G A G G C
T A A CATTC
A - T
C - G
G - C
G - C
C - G
T T
T G
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |