Sequence ID | >WENV170935661 |
Genome ID | MDTG01260854 |
Search identical group | |
Phylum/Class | [MDTG] marine metagenome; seawater |
Species | |
Start position on genome | 1173 |
End posion on genome | 1247 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aataactaaA |
tRNA gene sequence |
GCTGGTGTAGCTCAATTGGTAGAGCAACTGATTTGTAATCAGTCGGTTATGAGTTCAAGT |
Downstream region at tRNA end position |
aaattctttt |
Secondary structure (Cloverleaf model) | >WENV170935661 Thr TGT A TAgt aaattctttt G - C C - G T - A G + T G - C T - A G - C T G T T T C T C A T A A A | | | | A T C T C G A T G A G C G | | | | T T G G A G C T A A CGGTT A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |