Sequence ID | >WENV170945369 |
Genome ID | MDUP01009996 |
Search identical group | |
Phylum/Class | [MDUP] marine metagenome; 85 m water sample from station 6 |
Species | |
Start position on genome | 410 |
End posion on genome | 500 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gcatgctgcT |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC |
Downstream region at tRNA end position |
aaaacctgtc |
Secondary structure (Cloverleaf model) | >WENV170945369 Ser GCT T GTtc aaaacctgtc G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G T C G G A G G G C G | | | T T T A A G C T G A G TACAGGAGGCAACTTCTGTC G + T C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |