| Sequence ID | >WENV170950051 |
| Genome ID | MEHZ011473022 |
| Phylum/Class | [MEHZ] marine metagenome; marine surface water |
| Species | |
| Start position on genome | 4 |
| End posion on genome | 80 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
nnnnnnntcc |
| tRNA gene sequence |
GGGCGAGTAACTCAGTTGGTTAGAGTGCATCCCTTACAAGGATGAAGTCGGGGGTTCGAG |
| Downstream region at tRNA end position |
taagtaccac |
| Secondary structure (Cloverleaf model) | >WENV170950051 Val TAC
c ACCA taagtaccac
G - C
G - C
G - C
C - G
G - C
A - T
G + T T G
T C T C C C A
T G A A | + | | | G
T C T C A G G G G G C
G | | | | T T
G G A G T
T T A G AAGTC
C - G
A - T
T - A
C - G
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |