| Sequence ID | >WENV170951051 |
| Genome ID | MEHZ011533142 |
| Phylum/Class | [MEHZ] marine metagenome; marine surface water |
| Species | |
| Start position on genome | 2998 |
| End posion on genome | 2911 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
tctcccccac |
| tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCTCGCTTGGAAAGCGGGTTGGGTTAACGCCCTC |
| Downstream region at tRNA end position |
tttgctttct |
| Secondary structure (Cloverleaf model) | >WENV170951051 Ser GGA
c GCCA tttgctttct
G - C
G - C
A - T
G - C
G - C
A - T
T - A T A
T T C C C C A
T G A C | | | | | G
G T C C G A G G G G C
G | | | T T
C T G G C
C T A G TTGGGTTAACGCCCTC
C - G
T + G
C - G
G - C
C - G
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |