| Sequence ID | >WENV170951613 |
| Genome ID | MEHZ011561481 |
| Phylum/Class | [MEHZ] marine metagenome; marine surface water |
| Species | |
| Start position on genome | 204 |
| End posion on genome | 277 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
cccctgtact |
| tRNA gene sequence |
GGTGGAGTGGCCGAGAGGCGAGGCAGCGGCCTGCAAAGCCGCGTACACGGGTTCGAATCC |
| Downstream region at tRNA end position |
gctacaaagc |
| Secondary structure (Cloverleaf model) | >WENV170951613 Cys GCA
t TCCA gctacaaagc
G - C
G - C
T - A
G - C
G + T
A - T
G - C T A
T T G C C C A
G A G | | | | | G
A G C C G A C G G G C
G | | | T T
G A G G C
C G A GTAC
G - C
C - G
G - C
G - C
C - G
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |