Sequence ID | >WENV170952950 |
Genome ID | MEHZ011622277 |
Search identical group | |
Phylum/Class | [MEHZ] marine metagenome; marine surface water |
Species | |
Start position on genome | 5423 |
End posion on genome | 5347 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
actttttatt |
tRNA gene sequence |
GTCTCCTTAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
tattagctcg |
Secondary structure (Cloverleaf model) | >WENV170952950 Arg TCT t GCCA tattagctcg G - C T - A C - G T + G C - G C - G T - A T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |