Sequence ID | >WENV170954509 |
Genome ID | MJUH01004399 |
Search identical group | |
Phylum/Class | [MJUH] soil metagenome; viral particles from soil sample F1 |
Species | |
Start position on genome | 134 |
End posion on genome | 58 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ctgataactc |
tRNA gene sequence |
GGGCGATTAGCTCAGCTGGTTAGAGCGCGTCACTGATAATGACGAGGTCGGAGGTTCGAG |
Downstream region at tRNA end position |
agtaaatgac |
Secondary structure (Cloverleaf model) | >WENV170954509 Ile GAT c ACCA agtaaatgac G - C G - C G - C C - G G - C A - T T - A T G T C T C C C A C G A A | + | | G T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C T - A C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |