Sequence ID | >WENV170957207 |
Genome ID | MJUQ01030626 |
Search identical group | |
Phylum/Class | [MJUQ] soil metagenome; viral particles from soil sample PT1 |
Species | |
Start position on genome | 337 |
End posion on genome | 261 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggatgttcaa |
tRNA gene sequence |
GGCTGGGTAGCTCAGCTGGTTAGAGCGCGGGATTCATAACCCCGAGGTCGAGTGTTCAAG |
Downstream region at tRNA end position |
aattttatct |
Secondary structure (Cloverleaf model) | >WENV170957207 Met CAT a ACCA aattttatct G - C G - C C - G T - A G - C G - C G + T T G T C T C A C A C G A A | | | | | A T C T C G G A G T G C G | | | | T T G G A G C T T A G AGGTC C - G G - C G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |