Sequence ID | >WENV170957265 |
Genome ID | MKFH01000132 |
Phylum/Class | [MKFH] bioreactor metagenome; Viral particles filtered from anaerobic culture of Methylomirabilis and AOM associated archaea |
Species | |
Start position on genome | 288 |
End posion on genome | 363 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cccggcaagt |
tRNA gene sequence |
GATGGTGTAGCTCAGCGGTTAGAGCGGTTGACTGTTAATCAACGGGTCGATGGTTCAAAT |
Downstream region at tRNA end position |
atgccggttt |
Secondary structure (Cloverleaf model) | >WENV170957265 Asn GTT t GCCA atgccggttt G - C A - T T - A G - C G - C T - A G - C T A T C T A C C A C G A A | | | | | A G C T C G G A T G G C G | | | | T T T G A G C T A G GGGTC G - C T - A T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |