| Sequence ID | >WENV170961635 |
| Genome ID | MLJW01000269 |
| Phylum/Class | [MLJW] mine drainage metagenome; sample collected from the inflow into an acid mine drainage treatment plant; enriched for |
| Species | |
| Start position on genome | 17411 |
| End posion on genome | 17487 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
aagtttacat |
| tRNA gene sequence |
GGTGATGTAGCTCAGCTGGTTAGAGCACAGGATTCATAATCCTGGGGTCGAGGGTTCAAG |
| Downstream region at tRNA end position |
ataaagacgc |
| Secondary structure (Cloverleaf model) | >WENV170961635 Met CAT
t ACCA ataaagacgc
G - C
G - C
T - A
G - C
A - T
T T
G + T T G
T C T C C C A
C G A A | | | | | A
T C T C G G A G G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
A - T
G - C
G - C
A - T
T A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |