Sequence ID | >WENV170962371 |
Genome ID | MRWF01013676 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 9639 |
End posion on genome | 9722 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gccctttttt |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGCGAAAGCTTCGGAG |
Downstream region at tRNA end position |
aaagtagtcg |
Secondary structure (Cloverleaf model) | >WENV170962371 Tyr GTA t ACCA aaagtagtcg G - C G - C A - T G - C G - C G - C G - C T A T C C T C C A T G A T | | | | | G G G C C C G G A G G C G | | | T T C A G G G C A A A CGCGAAAGCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |