Sequence ID | >WENV170962757 |
Genome ID | MRWF01025689 |
Search identical group | |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 12205 |
End posion on genome | 12281 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tcgcgataat |
tRNA gene sequence |
GCCCCCGTAGCTCATCTGGATAGAGCGTCCCCCTCCTAAGGGGAAGGTAGCAGGTTCGAG |
Downstream region at tRNA end position |
gttgcccttc |
Secondary structure (Cloverleaf model) | >WENV170962757 Arg CCT t ACCA gttgcccttc G + T C - G C - G C - G C - G C - G G - C T G T C G T C C A C T A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A G AGGTA T - A C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |