Sequence ID | >WENV170962798 |
Genome ID | MRWF01027302 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 192567 |
End posion on genome | 192478 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
caccccccgc |
tRNA gene sequence |
GGAGAGGTGCCGGAGTGGTCGAACGGGGCGGTCTCGAAAACCGTTGTGGGTGCAAGCCCA |
Downstream region at tRNA end position |
ctttccctta |
Secondary structure (Cloverleaf model) | >WENV170962798 Ser CGA c GCCA ctttccctta G - C G - C A - T G - C A - T G - C G + T T A T G T C C C A T G A G | | | | | G G G G C C C A G G G C G | | | T T T A C G G C G A G TGTGGGTGCAAGCCCACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |