Sequence ID | >WENV170962823 |
Genome ID | MRWF01027957 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 24471 |
End posion on genome | 24560 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acgggtcagc |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTAGGCGGGAAACCGTC |
Downstream region at tRNA end position |
ttttcctcaa |
Secondary structure (Cloverleaf model) | >WENV170962823 Ser GCT c GCCA ttttcctcaa G - C G - C A - T G - C A - T C - G G - C T A T T A C C C A T G A G + | | | | G G G C C G G T G G G C G | | | T T T A G G C C G A G TAGGCGGGAAACCGTCTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |