Sequence ID | >WENV170963004 |
Genome ID | MRWG01000001 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 213768 |
End posion on genome | 213693 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aagttagcgt |
tRNA gene sequence |
TGGGGTATAGCCAAGTTGGTAAGGCAACGGGTTTTGATCCCGTCATTCCCAGGTTCGAGT |
Downstream region at tRNA end position |
cttattctcc |
Secondary structure (Cloverleaf model) | >WENV170963004 Gln TTG t GCCA cttattctcc T - A G - C G - C G - C G - C T - A A - T T G T G G T C C A T G A A | | | | | G T A C C G C C A G G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |