Sequence ID | >WENV170963061 |
Genome ID | MRWG01000007 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 91260 |
End posion on genome | 91344 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agcccttctc |
tRNA gene sequence |
GCGGGCGTGGCGGAATTGGTAGACGCGCTGGATTTAGGTTCCAGTGCCGCAAGGTGTGGG |
Downstream region at tRNA end position |
ggccggaagc |
Secondary structure (Cloverleaf model) | >WENV170963061 Leu TAG c ACCA ggccggaagc G - C C - G G - C G - C G - C C - G G - C T G T C T C C C A T A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TGCCGCAAGGTGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |