Sequence ID | >WENV170963207 |
Genome ID | MRWG01000039 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 208693 |
End posion on genome | 208766 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tccacccaat |
tRNA gene sequence |
GGCTGGGTGGCAGAGTGGTTATGCAGCGGCCTGCAAAGCCGTGGACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
ttttccgatc |
Secondary structure (Cloverleaf model) | >WENV170963207 Cys GCA t TCCA ttttccgatc G - C G - C C - G T - A G - C G - C G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T T A GGAC G + T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |