Sequence ID | >WENV170963247 |
Genome ID | MRWG01000062 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 41751 |
End posion on genome | 41837 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cctgcaaagg |
tRNA gene sequence |
GCCTCTGTGGCGGAACTGGTAGACGCGACGGATTCAAAATCCGTTTCTGGTGACAGAGTG |
Downstream region at tRNA end position |
attgcatagg |
Secondary structure (Cloverleaf model) | >WENV170963247 Leu CAA g ACCA attgcatagg G + T C - G C - G T - A C - G T - A G - C T G T C G G C C A C A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G G TTCTGGTGACAGAGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |