Sequence ID | >WENV170963248 |
Genome ID | MRWG01000063 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 96681 |
End posion on genome | 96767 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tgtgggctaa |
tRNA gene sequence |
GCCGGGATGGCGGAACTGGTAGACGCGCCAGACTCAAAATCTGGTTCTGGTAACAGAGTG |
Downstream region at tRNA end position |
tctttgatgc |
Secondary structure (Cloverleaf model) | >WENV170963248 Leu CAA a ACCA tctttgatgc G - C C - G C - G G - C G - C G - C A - T T T T C G C T C A C A A G | | | | | G T G G C G G C G A G C G | | | T T G A C G C T A G G TTCTGGTAACAGAGT C - G C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |