Sequence ID | >WENV170963553 |
Genome ID | MRWG01000285 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 315424 |
End posion on genome | 315498 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tgagcggtct |
tRNA gene sequence |
TGGGGCGTAGCCAAGCGGTAAGGCAGCGGTTTTTGGTACCGCCATGCGCAGGTTCGAATC |
Downstream region at tRNA end position |
accgcccgca |
Secondary structure (Cloverleaf model) | >WENV170963553 Gln TTG t GCCA accgcccgca T - A G - C G - C G - C G - C C - G G - C T A T C G T C C A G A A | | | | | G C A C C G G C A G G C G | | | T T G A G G C T A A CATGC G - C C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |