Sequence ID | >WENV170963581 |
Genome ID | MRWG01000313 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 70574 |
End posion on genome | 70663 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgggcgaccc |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGCTGAAGGCGCACGCTTGGAAAGCGTGTATACGGGAAACCGTA |
Downstream region at tRNA end position |
agggtttcgg |
Secondary structure (Cloverleaf model) | >WENV170963581 Ser GGA c GCCG agggtttcgg G - C G - C A - T G - C G - C G - C G + T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TATACGGGAAACCGTATC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |