Sequence ID | >WENV170963878 |
Genome ID | MRWG01001118 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 13033 |
End posion on genome | 12951 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
actcgcaatt |
tRNA gene sequence |
GCAGGCGTGGTGGAATTGGTAGACACGCTAGACTTAGGATCTAGTGCCGCAAGGTGTGGG |
Downstream region at tRNA end position |
aatgaaaaga |
Secondary structure (Cloverleaf model) | >WENV170963878 Leu TAG t ACag aatgaaaaga G + T C - G A - T G - C G - C C - G G - C T G T C C C T C A T A A G | | | | | G T G G T G G G G A G C G | | | T T G A C A C T A G G TGCCGCAAGGTGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |