Sequence ID | >WENV170964460 |
Genome ID | MRWG01013526 |
Search identical group | |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 70 |
End posion on genome | -1 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
caaaccctgc |
tRNA gene sequence |
TGGGGGATAGTTTAGCGGTAGAACTTCCGGCTCTGACCCGGACAGCCCTGGTTCGAATCC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170964460 Gln CTG c NNnn nnnnnnnnnn T - A G - C G - C G - C G - C G - C A - T T A T G G A C C A G A A | | | | | G C T T T G C C T G G C G + | | | T T G G A A C T A T CAGC T - A C - G C - G G - C G - C C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |