Sequence ID | >WENV170964567 |
Genome ID | MRWG01019472 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 2963 |
End posion on genome | 3047 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aggacgagat |
tRNA gene sequence |
GGAGGAGTGCCCGAGTGGCTAAAGGGGACGGACTGTAAATCCGTTGGCTATGCCTACGTT |
Downstream region at tRNA end position |
tcgttcctgg |
Secondary structure (Cloverleaf model) | >WENV170964567 Tyr GTA t ACCA tcgttcctgg G - C G - C A - T G - C G - C A - T G - C T A T C A A C C A T G A G | | | | | G G G C C C G T T G G C G | | | T T C A G G G T A A G TGGCTATGCCTAC A - T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |