Sequence ID | >WENV170964975 |
Genome ID | MRWG01092929 |
Search identical group | |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 134 |
End posion on genome | 210 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gaaaagtttt |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGTTGCCCTCCGGAGGCAAAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
aataannnnn |
Secondary structure (Cloverleaf model) | >WENV170964975 Arg CCG t GCCA aataannnnn G + T C - G G - C C - G C - G C - G G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A G AGGTC T - A T - A G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |