Sequence ID | >WENV170965697 |
Genome ID | MTEV01000581 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 1140 |
End posion on genome | 1048 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tcctagagct |
tRNA gene sequence |
GGAGACGTGGCCGAGAGGTTGAAGGTACTCCCCTGCTAAGGGAGCATACGGCTTATACCC |
Downstream region at tRNA end position |
gctggaatta |
Secondary structure (Cloverleaf model) | >WENV170965697 Ser GCT t GCCA gctggaatta G - C G - C A - T G - C A - T C - G G - C T A T C T C C C A A G A G | | | | | G G G C C G G A G G G C G | | + T T T A G G T T G A A CATACGGCTTATACCCGTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |