| Sequence ID | >WENV170965759 |
| Genome ID | MTEV01002061 |
| Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
| Species | |
| Start position on genome | 49488 |
| End posion on genome | 49577 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
caaggcagac |
| tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTTGAAGGCGCACGCCTGGAACGCGTGTATACGGGAAACCGTA |
| Downstream region at tRNA end position |
ttatcatcca |
| Secondary structure (Cloverleaf model) | >WENV170965759 Ser GGA
c GCCA ttatcatcca
G - C
G - C
A - T
G - C
A - T
G - C
G + T T A
T C T C C C A
T G A G | | | | | G
G G C C G G A G G G C
G | | | T T
T A G G C
T G A G TATACGGGAAACCGTATC
C - G
A - T
C - G
G - C
C - G
C C
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |