Sequence ID | >WENV170965759 |
Genome ID | MTEV01002061 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 49488 |
End posion on genome | 49577 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
caaggcagac |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTTGAAGGCGCACGCCTGGAACGCGTGTATACGGGAAACCGTA |
Downstream region at tRNA end position |
ttatcatcca |
Secondary structure (Cloverleaf model) | >WENV170965759 Ser GGA c GCCA ttatcatcca G - C G - C A - T G - C A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C T G A G TATACGGGAAACCGTATC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |