Sequence ID | >WENV170965875 |
Genome ID | MTEV01008296 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 2190 |
End posion on genome | 2273 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gccgccatct |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGAGCAGACTGTAAATCTGCCGCGAAAGCTTCGAAG |
Downstream region at tRNA end position |
gattgttcca |
Secondary structure (Cloverleaf model) | >WENV170965875 Tyr GTA t ACCA gattgttcca G - C G - C A - T G - C G - C G - C G - C T A T C T T C C A T G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A A CGCGAAAGCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |