Sequence ID | >WENV170965986 |
Genome ID | MTEV01011550 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 895 |
End posion on genome | 803 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atattgtaac |
tRNA gene sequence |
GGAGGTATACCCAAGTCTGGCTGAAGGGATCGGTCTTGAAAACCGACAGGCGGGTAACAC |
Downstream region at tRNA end position |
gttttaaatt |
Secondary structure (Cloverleaf model) | >WENV170965986 Ser TGA c TCCA gttttaaatt G - C G - C A - T G - C G - C T - A A - T T A T C T C C C A C T G A A | + | | | G T A C C C G G G G G C G | | | T T G A G G G C T G A A CAGGCGGGTAACACCGCGC T - A C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |