Sequence ID | >WENV170966017 |
Genome ID | MTEV01011754 |
Search identical group | |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 31935 |
End posion on genome | 32019 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcagcaacgt |
tRNA gene sequence |
GCGGGTGTGGTGGAACTGGTAGACGCGCCGGACTCAAAATCCGGTTCCGAAAGGAGTGTC |
Downstream region at tRNA end position |
tcttacaaac |
Secondary structure (Cloverleaf model) | >WENV170966017 Leu CAA t ACCA tcttacaaac G - C C - G G - C G - C G - C T - A G - C T T T C A G C C A C A A G | | | | | G T G G T G G T C G G C G | + | T T G A C G C T A G G TTCCGAAAGGAGT C - G C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |