| Sequence ID | >WENV170969697 |
| Genome ID | MTKW01037126 |
| Phylum/Class | [MTKW] anaerobic digester metagenome; anaerobic digester fed with sludge from wastewater treatment plant |
| Species | |
| Start position on genome | 887 |
| End posion on genome | 962 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
tatcctagat |
| tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGTCAGCCTTCCAAGCTGAATGTCGCGGGTTCGAGC |
| Downstream region at tRNA end position |
gaatcaggtt |
| Secondary structure (Cloverleaf model) | >WENV170969697 Gly TCC
t TCCA gaatcaggtt
G - C
C - G
G - C
G - C
G - C
A - T
A - T C G
T T G C C C A
T G A A + | | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A G ATGTC
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |