Sequence ID | >WENV170976446 |
Genome ID | MTKZ01007866 |
Search identical group | |
Phylum/Class | [MTKZ] anaerobic digester metagenome; anaerobic digester fed with sludge from wastewater treatment plant |
Species | |
Start position on genome | 13072 |
End posion on genome | 13000 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcccacttga |
tRNA gene sequence |
GCCCAAGTAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAATGTCCCCGGTTCGAGT |
Downstream region at tRNA end position |
atttttttgc |
Secondary structure (Cloverleaf model) | >WENV170976446 Phe GAA a Atga atttttttgc G - C C - G C - G C - G A - T A - T G + T T G T G G G C C A T G A A | | | | | G T C T C G C C C G G C G | | | | T T G G A G C G A G ATGTC T - A C - G A - T G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |