Sequence ID | >WENV170977339 |
Genome ID | MTKZ01021443 |
Search identical group | |
Phylum/Class | [MTKZ] anaerobic digester metagenome; anaerobic digester fed with sludge from wastewater treatment plant |
Species | |
Start position on genome | 7306 |
End posion on genome | 7232 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
attttcatct |
tRNA gene sequence |
GGCCCCATAGGATAACGGCTAGTCCACCGGATTCTCAGTCCGAAGGTCGGGGTTCGATTC |
Downstream region at tRNA end position |
gggtattcca |
Secondary structure (Cloverleaf model) | >WENV170977339 Glu CTC t GCCA gggtattcca G + T G - C C - G C - G C - G C - G A - T T T T G C C C C A C A A A | | | | | G G T A G G C G G G G C G + | | | T T C G T C C T A A AGGT C A C - G G - C G - C A - T T G T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |