| Sequence ID | >WENV170977797 |
| Genome ID | MTKZ01031808 |
| Phylum/Class | [MTKZ] anaerobic digester metagenome; anaerobic digester fed with sludge from wastewater treatment plant |
| Species | |
| Start position on genome | 937 |
| End posion on genome | 1013 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
actgagtcaa |
| tRNA gene sequence |
CGCGGGGTGGAGCAGCTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCATAGGTTCAAA |
| Downstream region at tRNA end position |
gtggaacccg |
| Secondary structure (Cloverleaf model) | >WENV170977797 Met CAT
a ACCA gtggaacccg
C T
G - C
C - G
G - C
G - C
G - C
G - C T A
T T A T C C A
C G A G | | | | | A
T C G A G A T A G G C
C | | | | T T
G G C T C
G T A G AGGTC
C - G
T - A
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |