Sequence ID | >WENV170978535 |
Genome ID | MTKZ01053278 |
Search identical group | |
Phylum/Class | [MTKZ] anaerobic digester metagenome; anaerobic digester fed with sludge from wastewater treatment plant |
Species | |
Start position on genome | 9980 |
End posion on genome | 9887 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttatatcagc |
tRNA gene sequence |
GGAGAGATGTCCGAGCGGCTGAAGGAGCACGACTGGAAATCGTGTGTATGCCCCCAAAGG |
Downstream region at tRNA end position |
tttttatttt |
Secondary structure (Cloverleaf model) | >WENV170978535 Ser GGA c GCCA tttttatttt G - C G - C A - T G - C A - T G - C A - T T A T C G C C C A C G A G | | | | | A G G C C T G C G G G C G | | | T T C A G G A T G A G TGTATGCCCCCAAAGGTGTACC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |