Sequence ID | >WENV170983670 |
Genome ID | MWVV01070724 |
Search identical group | |
Phylum/Class | [MWVV] soil metagenome; PT-2 sample; Antarctic (ecotone) soil |
Species | |
Start position on genome | 667 |
End posion on genome | 743 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaatgttcgt |
tRNA gene sequence |
GGCTGGGTAGCTCAGCTGGTTAGAGCGCGGGATTCATAACCCCGAGGTCGAGTGTTCAAG |
Downstream region at tRNA end position |
caattttaac |
Secondary structure (Cloverleaf model) | >WENV170983670 Met CAT t ACCA caattttaac G - C G - C C - G T - A G - C G - C G + T T G T C T C A C A C G A A | | | | | A T C T C G G A G T G C G | | | | T T G G A G C T T A G AGGTC C - G G - C G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |