Sequence ID | >WENV170988508 |
Genome ID | MWVX01519386 |
Search identical group | |
Phylum/Class | [MWVX] soil metagenome; MtG-4 sample; Antarctic (ecotone) soil |
Species | |
Start position on genome | 269 |
End posion on genome | 196 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaatccaccc |
tRNA gene sequence |
GGCGCCTTGGCGGAGTGGTTACGCAGCGGTCTGCAAAACCGCGTACACCGGTTCAAATCC |
Downstream region at tRNA end position |
aaccaattat |
Secondary structure (Cloverleaf model) | >WENV170988508 Cys GCA c TCCA aaccaattat G - C G - C C - G G + T C - G C - G T - A T A T T G G C C A G A G | | | | | A T G G C G A C C G G C G | | | T T G A C G C T T A GTAC G - C C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |