Sequence ID | >WENV170993496 |
Genome ID | MWWB01327380 |
Search identical group | |
Phylum/Class | [MWWB] soil metagenome; MS4-1 sample; Antarctic (ecotone) soil |
Species | |
Start position on genome | 171 |
End posion on genome | 245 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttagaacttT |
tRNA gene sequence |
GCCCTTGTAGCTCAACGGTTAGAGCAGCAGACTCATAATCTGTTGGCTGTAGGTTCGAAT |
Downstream region at tRNA end position |
aaattttcag |
Secondary structure (Cloverleaf model) | >WENV170993496 Met CAT T ATtt aaattttcag G - C C - G C - G C - G T - A T + G G - C T A T C A T C C A C A A A | | | | | G G C T C G G T A G G C G | | | | T T T G A G C T A A TGGCT G + T C - G A - T G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |