| Sequence ID | >WENV170996332 |
| Genome ID | MWWF01220023 |
| Phylum/Class | [MWWF] soil metagenome; MGM-3 sample; Antarctic (ecotone) soil |
| Species | |
| Start position on genome | 365 |
| End posion on genome | 289 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
acgacacatt |
| tRNA gene sequence |
GGGTCTGTAGCTCAGGTGGTTAGAGCGCGCCCCTGATAAGGGCGAGGCCGGTGGTTCGAG |
| Downstream region at tRNA end position |
ctctgaatga |
| Secondary structure (Cloverleaf model) | >WENV170996332 Ile GAT
t ACCA ctctgaatga
G - C
G - C
G - C
T - A
C - G
T - A
G - C T G
T C C T C C A
G G A A | | | | G
T C T C G G G T G G C
G | | | | T T
G G A G C
T T A G AGGCC
C - G
G - C
C - G
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |