Sequence ID | >WENV170997439 |
Genome ID | MWWG01133097 |
Search identical group | |
Phylum/Class | [MWWG] soil metagenome; MG6-4 sample; Antarctic (ecotone) soil |
Species | |
Start position on genome | 118 |
End posion on genome | 43 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tgaacctccc |
tRNA gene sequence |
GCGAGAGTAGCTCAGTTGGTAGAGCGCGACCTTGCCAAGGTCGAGGTCGCGAGTTCGAAC |
Downstream region at tRNA end position |
aattgttaaa |
Secondary structure (Cloverleaf model) | >WENV170997439 Gly GCC c TCCA aattgttaaa G - C C - G G - C A C G - C A - T G - C C A T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G AGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |