Sequence ID | >WENV170998557 |
Genome ID | MWWJ01043795 |
Search identical group | |
Phylum/Class | [MWWJ] soil metagenome; CN-4 sample; Antarctic (ecotone) soil |
Species | |
Start position on genome | 359 |
End posion on genome | 285 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tcaggtttaT |
tRNA gene sequence |
GCTCGCGTAGCTCAGTGGATAGAGTGCTTCCCTCCGAAGGAAGAAGTCGCAGGTTCAAAT |
Downstream region at tRNA end position |
gattatttaa |
Secondary structure (Cloverleaf model) | >WENV170998557 Arg CCG T ATtc gattatttaa G + T C - G T - A C - G G - C C - G G - C T A T C G C C C A T G A A | | | | A G C T C G G C A G G C G | | | + T T A G A G T T A G AAGTC C - G T - A T - A C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |